#NEXUS

BEGIN DATA;

DIMENSIONS NTAX=15 NCHAR=322;

FORMAT DATATYPE=DNA MISSING=? GAP=: SYMBOLS= "ACGT";

OPTIONS MSTAXA=UNCERTAIN ;

MATRIX

Wurdackanthus_frigidus_GRC8211_AY143370 GCCTC:TTCCCGAGGGCGA:CCGAGACGCCTGC:GATATTCGAAACGCTTTATCCGCGCGCACG:CTCTTATTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTTCGTGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACTCGGTCGACCGAATCCCTCTGTTTGTGCCCCTGTCGGAAGCTTTTTCGA:CC:GCCCCTCCCGTATTTCTCCGTTTTCCGA:TGCCGTTGGAACTTGTGGCGTCCC:ACCTTGTCATTCAAATGGGCAAGGACGCGCATTCYTGACGGGTGCGATCAAACC [308]

Wurdackanthus_argyreus_BRS1617_AY143371 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTCGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:AC??TGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_nsp3_PAR1592_AY143372 GCTTC:ATCCCGATGTTGA:CCGASACGCCTGTCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCATCACGTTTTTCCCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_macranthus1_JL15099_AY143373 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTAYATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGTCTCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGATTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCGTTCAAGTGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_vasculosus_LJD5474_AY143374 GCTTC:ATCCCGATGT?GA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTCGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_macranthus2_JL6620_AY143375 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGTCTCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCGTTCAAATGGCCAAGGACGCGCATTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_brittonianus_JCS17684_AY143376 GATTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGGTTCGAAACGCTATGTCTGCGCGCACG:CTCATAYTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCATCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_nerioides1_GS2164_AY143377 GCTTC:ATCCCGATGTCGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTCGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:T?GACTGAAGT:CCAT:TGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_nsp2_HW8511_AY143378 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTCCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGAGCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_pulcherrimus_JM1600_AY143379 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATTTTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACTCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCGCGTCACGTTTTTCTCCGTCTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGCCATTCAAATGGCCAAGGACGCGCCTTCTCGACGGGTGCGATCATACC [308]

Symbolanthus_nerioides2_GRP49150_AY143380 GCTTC:ATCCCGATGTCGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATATTCACGGCGGCCG:TAATATGTC:GTCGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TCGACTGAAGTTCCAGATGCGCCGTGACCCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCCCTTCACGTTTTTCTCCGTTTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGTCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [310]

Chelonanthus_alatus_SM24076_AY143381 GTGGCGTTC?::::GAAGA?:CGAGGCGTCCGTCGAAATTCGAGACGCGATATCGCAGCGCACG:CTTGGAGTCACGGCGGCCG:TAATATGTC:GTCGGACTCGTCTCGTCGGGCCCCACAGTGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACTCGGCTGAA:GAATCCCTCCATT?GGCCGCCGATCGG:ACAACTTTACCGTC:GCCCTCCACGTGTTCCCGCGTTT::CGAATGCGGTT?GAGCTTCGGGCGTCCC:CCGTTGTCGTTCAAATGTAGA:GGACGCGC?:ACTTGACGGGTG:::::::::: [292]

Symbolanthus_nsp1_TBC25922_AY143382 GCTTC:ATCCCGATGTTGA:CCGAGACGCCTGCCGAGATTCGAAACGCTATATCTGCGCGCACG:CTCATTTTCACGGCGGCCG:TAATATGTC:GTTGGACTCGTCTTTCCGGGGCCCACGACGCCGCAA:TTGACTGAAGT:CCAT:TGCGCCGTGACTCGGTCGACCGAATCTCTGTGTTTGTGCCCCTTTCGGAAGCATTTTCGA:TC:GCGCATCACGTTTTTCTCCGTCTT:CAA:TGCCGCTGGAACTTGTGGCGCCCC:ACCTTGCCATTCAAATGGCCAAGGACGCGCCTTCTTGACGGGTGCGATCATACC [308]

Symbolanthus_nsp4_LJD6691_AY143383 GCTTC:ATC?CGATGTTGA:GTGAGACACATGT?GAGT?TC?A???G?T?TATCTGCGCACATG:ATCATATACACGG?GG?CG:TAATATGTC:GTTGGA?TCGTCTTTCCGGAGCCCATTCGGCCGCAAATTGATTGAAGT:CGAT:TGCGC?GTGATCCGGTCGACCGAATCT?TGTGTTTGTGC??CTTTCGGAAGCATTTTCGA:TC:G??CATCAAGTTTTCCTAAGTTTT:CAA:TGCCGGTGGAAC?TGTGGCG?C?CCACCTTGTCATTCAAATGGTCAA?GAGGCGACTTCCTGACTGGTGCGATCACA:: [308]

Chelonanthus_albus_JMP2049_AY143384 GCT:CC?CGGTCAGGCCGGGA?GW?GAT?GTTTTCG::::??AG?CGCTATATCGCAGCGCACGCCTTGGAGTCACGACGGCCCGTAATATGTC?GTCGGACTCGTCTCGTCGGGCCCCAC?GTGCCGCAA:TTGACTGA?GT:CCAG:TGG?CAGCGG?TCGTCTGAC:GAATTCCTACA?TAGGCTG?ATTTTGGGACACGTTTACTCTCTGCCCTCCT?GTAGTTTCGCGTTT::AGAAGGCCGTTCGAACTTCTGGCGTCCCCTCCT:GACGTTCACATGGTCG?GGACGCGGCTA?ATGACGGGTGCGATCACAG: [308]

;

END;

 

BEGIN CODONS;

CODESET * UNTITLED = Universal: all ;

END;

BEGIN ASSUMPTIONS;

OPTIONS DEFTYPE=unord PolyTcount=MINSTEPS ;

ENDBLOCK;

begin paup;

constraints wurdackanthus (monophyly) = ((1,2));

constraints symbolanthus (monophyly) = ((3,4,5,6,7,8,9,10,11,13,14));

ENDBLOCK;

 

 

BEGIN MACCLADE;

Version 3.05;

LastModified -1287338437;

Singles 1000&/0;

END;