'aligned trnL intron sequences for Gentianaceae and outgroups, 30 October 1998, see Struwe et al., Harvard Papers in Botany, vol. 3, note that Genbank numbers follow taxon names'

 

750 151

 

Alstonia_boonei_AF102374                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAA-A---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTTAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------------------------------AA--GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CTGTATTT-TTTCTATGA----AAAATGGAGGAATT------GGTGTGAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-AAGA---TCTTT--TGAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Anthocleista_amplexicaulis_AF102375     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Anthocleista_scandens_AF102376          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTACG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAA-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Anthocleista_vogelii_AF102377           AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA------GCAAAAAG----------GAAAG?TCAG---------AAAGRAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Antirhea_acutata_AF102378               -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAA-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCAACTGAAT----CTGTATTTTTATATACGG---AAAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Antonia_ovata_AF102379                  ----------------GGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATAGAAGAATT------GGTGTGAA-----TCGTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Apocynum_cannabinum_AF102380            AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAC---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------CCACAA-------AC----------------AAAGGTTCCG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGACG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTGATCAAACGATTCACTCCATAGTCTG-TTGATCCTCTTT--TCAAGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGGTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Asclepias_curassavica_AF102381          AATTGGATTG-GCCTTGGTAGGGAA-CCTATTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGGCG-CGTTGGTAGTTGGTAGA-GAAC-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAG----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGACTACTATATCAAA-T-------ATATCAAAT-----GATTAATGC-C----GACCCCAATGAGT----CTATATTT-TTTCTATAAAAAAAAAACGGAAGAATT------GATGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGAT---------CACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGGTGGCAACAATG-----------------AAATTTTTAGT-AAGAGG  

Aspidosperma_megalocarpon_AF102382      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAA-----------------A-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAGGGTTCAG---------AAAACGAAAA-A---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAAA-GAAA-------TCTTTCCATCAAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTCTATGA----AAAATGGAAGAATT------GGCGGGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAACGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Bartonia_virginica_AF102383             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGTTAATTTTCAAATTCAGAGAAAGCCTGGAATTAAT---------------AA-AAA-GGTCAATCCTGAGCCAAATCCTATT-------------------AAAA--------GGAAAAAG----------AAAGACTTAA---------ACAGAAAAA------------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAACATCTAACAAATAGA--------GTTAATTG-C-------GTTGGTAAC-GAAA-------CTTTTTCACAACAAATTATA-----------------AAAGGAT----------------GAAA-AAGAAAAG------TATA-------TCCC---------------------AACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGACTG-TAGA---TCTTT--TCAAGAAATG---ATTAAT-------T-GGACGA-GGA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------CAATTTATAGC-GAGAGG  

Blackstonia_imperfoliata_AF102384       AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------AG-AAAAG----------AGAGGCTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCAAAAATTCCG-----------------AAAAGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTCTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAAAGATTCAC-CCAGAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Bonyunia_minor_AF102385                 ??????ATTGAGCCTTGGTATGGATACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCCTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGGCAACAATG-----------------A-----------------  

Bonyunia_superba_AF102386               -ATTAGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCCTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Calolisyanthus_pendulus_AF102387        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Calolisyanthus_pulcherrimus_AF02388     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGC?TG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Canscora_diffusa_AF102389               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------CAATGGA--------GTTGATTG-CGTTGGT-GTTGGTCGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------CAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATATCTTG-TATA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Canscora_pentanthera_AF102390           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG--AAAAG---AAAGGCCCAG---------AAATAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAT-ACGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGCGATTCAC-CCATACCTTG-TAGA---TCTTTA-TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Carissa_bispinosa_AF102391              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCAGTTTT----------------CCACAA-------AC----------------AAAGATTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CTGTATTT-TTTCTATAA----AAAATGGAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGACAACAATT-----------------AAATTTATAGT-AAGAGG  

Catharanthus_roseus_AF102392            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCAGTTTT----------------CCACAA-------ACACAAAC----------AAAGGTTCAG---------AAAACGAAAA-A---------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGACAAATGGAGTTGGCCG-C-------GTTGGTAGA-GAAA---CAAACCTTTCCATCCAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CCGTATTT-TGTCTATAA-----AAATGTAAGA--------------GAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Centaurium_cf_barrelieri_AF102393       AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAAAAAGGATAGGTGCAGAGACTCAAAGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Centaurium_maritimum_AF102394           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Cerberiopsis_candelabra_AF102395        AATTGGATTGACCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAACTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CCGTATTT-TTTCTATAA-----AAATGGAAGAATT------GGTGTAAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAGATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Chelonanthus_alatus_AF102396            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTGAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-TCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Chelonanthus_albus_AF102397             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTT?TGCA-TGTCAATGCCG?CA??AATG-----------------AAATTTATA??-ATGAGG  

Chelonanthus_purpurascens_AF102398      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAACAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Chelonanthus_viridiflorus_AF102399      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAAT---AATAA-AATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Chiococca_alba_AF102400                 --TTGGATT-GACCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------TCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GCTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCCAAAATTCAG-----------------AAAGAAT-----------GAGGTGAAG-GAGAAACG------TATA-------TACAT-ACG---------TATTGAATACTATATCAAAAT-----------CAAAT-----GATTAATGA-C----GACTCGACAGAAT----CTGTATTTATATATATAA----AAAACGGAAGAATT------AATGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGT---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Chionogentias_bellidifolia_AF102401     ATTAGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAATAT------TAAAAT-AAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Chironia_baccifera_AF102402             AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAAAA-----AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Cicendia_filiformis_AF102403            AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTTAG---------AAAA-AAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-GAAA-------TATTTCCATCACAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG--TATATATA-------TACAT-ACG---------GATGGACGACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGA-------CATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Cicendia_quadrangularis_AF102404        AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAA-------ACAAAAAG----------AAAGGCTTAG---------AAAACAAAAAAAAAA------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGG--------GTTGATTA-C-------GTTGGTATA-GAAA-------TATTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG--TATATATA-------TACAT-ACG---------GATGGACGACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGA-------CATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Coffea_arabica_AF102405                 --------------TTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CCAAAGG-----------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCTAAAATTCCG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-----------T-ACG---------TATTGAATACTATAT-----------------TAAAT-----GATTAATGA-C----GACTCAACTGAAT----CTGTATTTTT-TATAT-A----AAAATGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Comastoma_nana_X77890                   AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAG--------------------AAAAAAA-----GCAAAAAG--AAA-----G???GCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT--GAAAAA--------GA---AAG???G-------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAACTT---ATAAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Comastoma_tenella_X77892                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAG--------------------AAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCC------------------AAAG-AT----------------GAAA-AAGAAAG-------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------GAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAACTT---ATTAAT-------C-G-ACGA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATACCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Condaminea_corymbosa_AF02406            -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----AACCCGACTGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCATATATTCATTGATCAAATGATTAACTCCATAGTCTGATAGA---TCTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Coutoubea_minor_AF102407                AATTGGATTGAGCCTTGGTATGGAAACCTGCTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT-------AAATTAATAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTA-C-------GTTGGTAGA-GAAA-------TCGTTCCATCGAAAACTCCG-----------------AAAGGAT-----------GAA--GAATAAAG-GACG------TATA-------TA----------------------AGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TCGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATTAAATTTCTAGT-AAGAGG  

Coutoubea_ramosa_AF102408               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AATAGG  

Coutoubea_spicata_AF102409              AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTT-CAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AATAGG  

Deianira_pallescens_AF102410            AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAACCCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------ATTTTTCCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GACG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG  

Dioicodendron_dioicum_AF102411          -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----AACCCGACTGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTTCACATTGAAGAAAGAA-----TCATATATTCATTGATCAAATGATTAACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Ditassa_sp_AF102412                     AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT-------------------------------------------------CGGTTCAG---------AAAATGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGAATACTATAT-----------------GAAAT-----GATTAATGC-G----GACCCAAATGAGT----CTATATTT-TTTCTATAA----AAAACGTAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTGTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTTTAGT-AAGAGG  

Djaloniella_ypsilostyla_AF102413        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCACATTCAGAGAAACCCTGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT-----------TTTTCAAAAA--------CAAAAAG----------AAAGTCTCAG---------AAAGAAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GGTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTTG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---CCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGTCGACAACAATG-----------------AAATTTAGAGT-AAGAGG  

Echium_vulgare_L33362                   --------TGAGCCTTGGTATGGAAACCTACTAAGTGACAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA?GGGCAATCCTGAGCCAAATCCGGTTTT----------------CCGAAA-------ACAAAC------------AAAAGTTGAA---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGACTG-C-------TTTGGTCGA-CGAA-------TCTTTC--TC------------------------AT-AAAGTGT----------------GAAA-G-------------TATA-------TACAT-TTG---------TATTGAATACTTTAT-----------------CAAATGAAATGATTAATGA-C-----TCCCAAAA---------TATATTTTTTTTT?AAA---AAAAAAAGAAGAGTT------GGTGTTAA-----TCAATTCCACATAGAAGAAAGAAAAGAGTCGAGTATTCATTGATCAAATTATTCACTCCATAGTCCGATAGA---TCTTT--TGAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTTTAGT-AATAGG  

Enicostema_verticillatum_AF102414       AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT-------------TTCAAAAA-------GCAAAAAG-ACAAAG---AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-CAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACCG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Eustoma_exaltatum_AF102415              AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAAA-AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Eustoma_grandiflorum_AF102416           -??TGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Exacum_affine_AF102417                  AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTACGAAA-------AG----------------AACGTGTCAG---------AAAGCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-TAAA-------TCTTTCCTTC-AAAATTCCG-----------------AAAGGCT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACCCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------GGTGTGAA-----GCGATTCCACATTCAAGAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATAACGACAACAATG-----------------CAATTTATAGT-ACGAGG  

Exacum_tetragonum_AF102418              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTCCGAAA-------AG----------------AACGGGTCAG---------AAAGCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGATTG-C-------GTTGGTAGA-TAAA-------TCTTTCCTTCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TATAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACTCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAATCTC-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG  

Fagraea_berteroana_AF10219              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AT-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTTAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAAATCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-A-G??G  

Fagraea_elliptica_AF102420              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTTAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAAATACG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CTACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Fagraea_fragrans_AF102421               AATTGGATTGAGTCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAA-----?GG-TAGGTGCAGAGACTCAACGGAAGCT-GT??TAAC-------AAATTGA--------GTTGATAG-C-------GTTGGTARA-RAAA-------CGTTTGCATCAAAATATCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGT?T--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCTTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATT?T-A-----  

Faramea_multiflora_AF102422             --------TGGGCCTTGGTATGGAAACCCGCTGAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAGTGTTCAT---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GGTAGTAGA-GAAG-------TCTTTCCATCAAAAATTCAGTAAGTATTAAAAGTATTAA-GGAT-----------GAAGTGAAG-GATAAACG------TATATACAATATACAT-ACG---------TAGTGAATAGTATAT-----------------TAAAT-----GAGTAATGA-CTAATGAC-AGCCTGAATGAATCTATGTTTTT-TCTATGA---AAAAAC-AAAGAATT------GGTGTGAA-----TAGATTCCACGTTGAAGAAAAAA-----TCTAATATTCATT------------CACTCCATAGTCTGATAGA---TCTTT--TCAACAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGCCACTGCTGGCAAAAATG-----------------AAATTTATAGTTAAGAGG  

Faroa_axillaris_AF102423                AATTG-ATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------TTTTTCAAAAA-------GCAAAAAG----------AAAGTCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT---------------AAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Faroa_schaijesiorum_AF102424            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT---------TTTTTCAAAA--------GCAAAAAG----------AAAGT?TCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTCG-----------------AAAGGATAAAAAAGGATAAATAAG-AT-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Frasera_paniculata_AF102425             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTCTTTTTT--------------AAAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAA--AGGAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATAGA--------GTTGATTG-C-------ATTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATAATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------G-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTATC-TGTCACTGCCGACAACAATG-----------------AAATTTATAGT-GATAGG  

Fraxinus_americana_X76812               --------------------------------AAGTGGTAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCAAA-------AC----------------AAAGGTTCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGACTG-C-------GTTGGTAGA-GGAA-------TCTTTCCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------------------------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGAATCTCT--ATCTGTATTTTTTTATATGA----AAAATGGAAGAA-T-------------------T-GATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGA---TCTTT--TAAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATACCGG-------------------------------------------  

Gardenia_taitensis_AF102426             -ATTGAATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATTCTGAGCCAAATCCCATTTT----------------CCGAAA-------CC----------------AAAGGT------------------GAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------ATTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCCG-----------------AAAGTAT-----------AAAGTGAAG-GATAAACG------TATA-------TA--T-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGACTGAAT----CTGTATTTTT-TATATGA----AAA-CGGAAGA--------------GAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Gardneria_ovata_AF102427                --------------TTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG---------------AAAAATTCA----------GAAGGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATATAAAAAT-----------AAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCCCTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATT-----------------AAATTTATAGT-AAGAGG  

Gelsemium_sempervirens_AF102428         AATTGGATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AG----------------AAAGGTTCAG---------AAAGGGAAAA-----------GGGATAGGTGCAGAGACTCGATGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-T-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATCCTG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATAA-T----GACCCGAATGAAT----CTATATTT-TTTATATGA----AAAATGGAAGAATT------AGTGTGAA-----TCGATTCCGCATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTTTAGT-AAGAGG  

Geniostemon_gypsophilum_AF102429        AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACGAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGT--A-GA--------------CCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Geniostoma_rupestre_AF102430            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGTAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTT-TATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentianella_anisodonta_X77870           AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-------------ATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Gentianella_aurea_AF102431              AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTCAATATAAATCTTAAAA-CAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TGCA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Gentianella_germanica_X77885            AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAATATGAA------AATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Gentianella_peruviana_AF102432          AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-------------ATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Gentianopsis_crinita_AF102433           AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAACCCTGAGCCAAATCCTA--AAA---------------AAAAAAA------GCAAAAAA--AAAAG---AAAGGCTCA?---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AA?GGAT----------------GAAG-AATAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAAAGG  

Gentiana_acaulis_X77869                 AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-GGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------TCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------T-----------------------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCGC-CCACAGCCTG-TAGA---TC----------AACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTGATAGT-AAGAGG  

Gentiana_alpina_X77868                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------------GAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGAAGA--TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_asclepiadea_X77871             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGCAAA-GAAA-------CCTTTC-ACCAAAAATTCCA-----------------AAAGG------------------GAAG-AAGAGGGG------TATA-------TA-----------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCAGTGTCAATGCAGACAACAATG-----------------AAATTTAGAGT-AAGAGG  

Gentiana_bavarica_X77873                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT-----------------------GAGGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------C-TGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_clusii_X77879                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------------GAAAAA------GCAAAAAG----------AAAGGATTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCT-CCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGA-CGG---ATAAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_cruciata_X77880                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATCCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACATCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AACAGG  

Gentiana_cruciata_AF102434              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATCCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_frigida_AF102435               AATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATATTTT--------------CAAAAAA------GCAAAAAGG---------AAAGGCTTAG-------T-AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA------TCTTTACTACCAAAAATTCCAT----------------AAAGGAT----------------GAAG-AAGAGGGT------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTAAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGTTGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_froelichii_X77884              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GCTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------GAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTAGAGT-AAGAGG  

Gentiana_lutea_X75702                   -ATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-G-A--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_punctata_X77894                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGA-----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAACACATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C--GACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_purpurea_X77893                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTGTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAA--------C--GACGA-GAA-TAAAGA-------GAGAGTCCCATTATGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_pyrenaica_X77895               AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT---------------GAAAAA------GCAAAAAAAAGAAAGGCTTAAGGCTTAG----AAATGA-AG---TAA-----------GTGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGT-----------------------------------------------------------------------------------------------G-AAGAGGGA------TATA-------TACA---------------------GAGTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-GCGCAGCCTG-TAGA---TCTTT--TCACGAACGT---ATTAAT-------C-GGACTA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_sedifolia_AF102436             AATTGGATTGAGCCTTGGTATGGAAAACTACTAAGTGATAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGGGCCAAATCCTATTTTT----------------GAAAAA------GTAAAAAAAAAAAAG---AAAGGCTTAA---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATCGA--------GTTGGT-----------------------------------------------------------------------------------------------G-AAGAGGGG------TATA-------TACA---------------------GAGTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAT-CCACAGCGTG-TAGA---TTTTT--TCACGAACAA---ATTAAT-------C-GGATTA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_terglouensis_X77897            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAGG-AAG-GGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------CAGGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_utriculosa_X77898              AATTGGATTGAGCCTTGGTATGGAAACCTATTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGAAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCT-CCAAAAATTCCA----------------AAAGGGAT----------------GAGG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------CA-GACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Gentiana_verna_X75704                   AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTAC-AAAAATTCCA-----------------AAAGG-T----------------GAGG-AAAAGGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG----TTAAT-------CA-G-CGA-GAAATAAAGA-------GAGAGTCCCATTCTGCAGTGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Halenia_palmeri_AF102437                AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTTT---------------AAAAAAA------G--AAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Halenia_sp_AF102438                     AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTTT---------------AAAAAAA------G--AAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Hamelia_papillosa_AF102439              --------------TTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAGGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCGAA-------AC----------------AACGGTTCAG---------AAAGTGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTCATGA-C----GACCCGACTGAAT----CCGTATTTTTATAGATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATCGATCAAACGATTCACTCCATGGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Hoppea_dichotoma_AF102440               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAA---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------AGAAAAAT----------AAAGGCACAG---------AAATAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-CATTGGT-GTTGGTAGA-GAAA-------TATTTCCATAGAAAATTCCG-----------------AACGGAT----------------AAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATAGGTTG-TAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TTAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCTGACAATAATG-----------------AAATTTATAGT-AAGAGG  

Hydrangea_paniculata_X85796             ------------CCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------CA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------ACAAAC------------AAAAGTTCAG---------AAAGCGAAAATCAAAA-A---AGGATAGGTGCAGAGACTCAATGGAAGCTTATTCTAAC-------AAATGGA--------GTTGACTG-CCTTGC--GTTGGTAGA-GGAA-------TCCTTTCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG--ATAAACC------TATATAC---ATACGTTACG----------ACTGAATATTATAT-----------------CAA-T-----GATTAATGA-C----GACCCGAATCTGT--ATCCGTATTTTT-GATATGA----AAAATGGAAGAATT------GTTGTAAA-----TCGATTCCAAATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAG?CTG?TAG?TCCTTTTT?TTGAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGAC??C?ATG-----------------AAA?T???AGT-AAGAGG  

Irlbachia_poeppigii_AF102441            AATTGGATTGAGCCTTGGTATGGAAACCTAATAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTTTT------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAGGGAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAGAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CTCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AGAGGA  

Irlbachia_pratensis_AF102442            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAACAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCCTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Ixanthus_viscosus_AF102443              ??TTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------AG-AAAAG----------AGAGGCTAAG---------AAAGCAAAAAAAAAA------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAAGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAAAGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTT?TGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Jaeschkea_oligosperma_AF102444          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-ATGAA----------AAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACG---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Jasminum_fluminense_AF102445            ----GGATTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCCAA-------AC----------------AAGAGTTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGACTA-G-------GTTGGTAGA-GGAA-------TCTTTCCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG-GATAAATAG-----TATA-------------------------TATTTTTTACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGAATCTCT--ATCTGTATTTTTTTATATGA----AAAATGGAAGA-TT-------------------T--ATTCCATTTTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCACAATCTGATAGA---TCTTT--TAAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTATAGT-AAAAGG  

Labordia_sp_AF102446                    AATT???TTGAGCCTTGGGATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGGTCAG---------ARAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCTAAAATTTAG-----------------AAAGTCT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTTTTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TAAAGAACGG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Labordia_tinifolia_AF102447             AATTGGCTTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGGTCAG---------AAAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCTAAAATTTAG-----------------AAAGTCT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTTTTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Lisianthius_jefensis_AF102448           AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAAAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTAATAGT-AAGAGG  

Lisianthius_laxiflorus_AF102449         ??TTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAAAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCATGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTTATAGT-AAGAGG  

Lisianthius_longifolius_AF102450        --???GATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAGAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTTATAGT-AAGAGG  

Logania_albiflora_AF102451              --TT-GATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTA?A-GAAA-------TCTTTCCATCGAAAATTCAG----------------------------------------ACAG-GATAAACG------TATA-------TACGT-ACG---------TATTTAATACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Lomatogonium_carinthiacum_X77899        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAT--------------------AAAAAA------G-AAAAAG----------AAAGGCTCAG---------AAAGAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACATCCTG-TCTA---TCTTT--TCACGAAATGTTTGTTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCCTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTAGAGT-GAGAGG  

Lomatogonium_oreocharis_AF102452        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAT-AA----------------AAAAAAA------GCAAAAAG---------TAAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTGGC-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT--GAAAGGAT------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCGCGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Luculia_gratissima_x_tsetensis_AF102453 -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTTAG-----------------AAAGGAC-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCAAATGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------AGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGCCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Macrocarpaea_domingensis_AF102454       AATTGGATTGAGCCTTGGTATGGAAACC?ACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------ATTTTTCAAAAA-------GCAAAAAA----------------------------------AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Macrocarpaea_cf_glabra_AF102455         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAAGAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGA?TCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Macrocarpea_valerii_AF102456            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AA--------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Macrocarpaea_rubra_AF102457             ??TTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT?--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Megacodon_stylophorus_AF102458          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG----------AAAAGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Mitrasacme_pilosa_AF102459              --TTGGATTGAGCCTTGGTATGGAA-CCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAGT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACGAAAAA----------CGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GGTGGCTG-C-------GTTGGTAGA-GCAA-------TCTTTCCATCAAAAATTCAG-----------------AAAGTAT----------------GAAG-GATAAACG------TATA-------TACAT-ACGTATTTTACGTATTTAATACTATATCACATTTTTAATGATATCAAAT-----GATTAATGA-C----GACACAAATGAAT----CTGTATTT-TTTATATGA----AAAATGCAAGAATT------GGTGTTAATTGAATGGATTCTACATTGAAGAAAGAA-----TCGAATAGTCATTGATCAAATGATTCACTCCATAGTCTG-TCGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Mitreola_petiolata_AF102460             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAA----------------GA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TCTA-------TACAT-ACG---------TATTTAATACTATAC-----------T-ATATCAAAT-----GATTAATGA-C----GATCCGAATGAAT----CTGTATTT--TTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTGACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Neblinantha_parvifolia_AF102461         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAATAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-CGTAATC-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Neuburgia_corynocarpa_AF102462          AATTGTATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAA----------------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACAA--------GAA-----TCGAATATTCATTGATCAAATTATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT??AGAGG  

Neurotheca_loeselioides_AF102463        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTTTTTTTTTT------C--TTTCGAGA--CTTTTTTCTTTTTG-------------GTTTTGG---------AAA--AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCAAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTACATCAAAAATTTCG-----------------AAAGGAT---AAAGAA-------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCATAGCCTA-TCGA---TCTTT--TCACGAACTG---AGTAAT-------C-GTACGA-GAA-GAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Obolaria_virginica_AF102464             AATTGGATTGAGCCTTGGTATGGAAACCTAATAAGTTATAATTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAAG---------AAAGGCTCAG---------AAAGAAAA-AAGGAAA-----AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------ATTGGTAAA-GAAA-------CCCTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AATAAGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------A-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Ornichia_madagascariensis_AF102465      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTCCGAAA-------AG----------------AACGGGTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA-------------------------GTTGGTAGA-TAAA-------TCTTTCCCTCAAAAATT-AG--------------AATAAAGGAT----------------GAAG-AAGAGAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCACTCCATAGCCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG  

Orphium_frutescens_AF102466             AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAGCAAAAAG---AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-TAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Pauridiantha_sp_AF102467                -ATTGGATTGAGCCTTGGTATGGAAACCCACTGAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGTAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGATTCAG---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GGTAGTAGA-GAAA-------TCTTTCCATCAAAAAT-CAG--------------AT--AAGGAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------TAAAT-----GAGTAATGA-G----AGCCCGAATGAAT----ATATATATTT-TCTATGA----AAAACGAAAGAATT------GGTGTGAA-----TAGATTCCGCGTTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TTAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGTTAAGAGG  

Periploca_graeca_AF102468               AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------ACACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGAT-GTTCTAAC-------AAATGGA--------GGTGGCCA-C-------GTTGGTAGA-GAAA-------TCCTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACA------CATA-------TACAT-ACG---------TATGGAATACTATAT-----------------CAAAT-----GATTA-TGC-C----GACCCGAATTCTT----CCGTATTT-TTTCTATAA----AAAACGGAAGAATT------GGTGTGAG-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGATCCCCTTT--TCAAGAAC-GG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Petunia_hybrida_X74572                  -------------CTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAAC---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------ACAAAC------------AAAGGTTCAG---------AAA--AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-ATTCTAAC-------AAATGGA--------GTTAAATG-C-------GTTGGTAGA-GGAA-------TCTTTACATCGAAACTTCAG-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAAT--------CCGTATTTTT-TCTATAA----AAAATCGAAGAATT------GGCGTGAC-----TCGATTCTACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAAA---TCTTT--TGAAGAACTG---ATTAAT-------C-G-ACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Portlandia_platantha_AF102469           -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------TCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCCAAAATTCAG-----------------AAAGAAT-----------GAAGTGAAG-GAGAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-A----GACTCGACGGAAT----CCGTATTTTTATATATGA----AAAACGGAAGAATT------AATGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCCGATAGT---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Potalia_amara_AF102470                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Potalia_resinifera_AF102471             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCC?ATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Potalia_resinifera_AF102472             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCGATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAG?AAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Pycnosphaera_buchananii_AF102473        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------TTTTTCAAAAA-CAAAAAGCAAAAAG----------AAAGTCTCAT---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTCG-----------------AAAGGATAAAAAAGGAT------ACAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTT-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Rondeletia_amoena_AF102474              -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CCAAAT------------CTAGGTTCAG---------AAAGTGAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAA-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTAAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGACTGAAT----CTGTATTTTTATATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTT---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAAAGG  

Rubia_fruticosa_AF102475                -ATTGGATTGGGCCTTGGTATGGAAACCTGCTGAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTTAG---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTCGA-GAAT-------TCTTTCCATCAAAAATTCAG--------AAAA-TA--CAAGTAT-----------TAAGTGAAG-GATAAACG------TATATAC--TATACAT-ACG---------TAGTGAATAGTATAG-----------------TAAAT-----CAGAAATCA-C----AGCCCCAATGAAT----CTATATTTTTTCATA-GA---AAAAATAT-AGAATTGTAATTGTTGTTAA-----AAGATTGCACGTTTAAGAAAGAA-----TCGAATATTCATTTATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TTACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGTTAAGAGG  

Sabatia_angularis_AF102476              AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------ATTTTTCCAAAA-------ACAAAAAG--GAAAT---AAAGGCTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATAAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Sabatia_gentianoides_AF102477           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTTTTTTT---------ATTTTTCCAAAA-------ACAAAAAG--GAAAT---AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCATG-TAGA---TCTTT--TCAAGATCTG---ATAAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATACCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Saccifolium_bandeirae_AF102478          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT--------------CAAAAAA------GCAAAAAAG---------AAGCGCTTAG-------T-AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAA?CT-GTTTTATC-------ATATGTA--------GTTG??TG-C-------GTTGGTAAA-GAAA-------CTTTTTCACCAAAAATCCAG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Schinziella_tetragona_AF102479          AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGAAAATTTTCAAATTCAGCGAAACTCTGGAATTAAA---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-CATTGGT-GTTGGTAGA-GAAA-------TATTTCCATCAAAAATTCCG-----------------AAAGGAT----------------AAAT-AAGAAA-----------A-------TACAT-ACG---------TATGAAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATCTCTTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

Schultesia_guianensis_AF102480          AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT-----------------CAAAT-----GATT-----------------------------------------------------------------------------------------------------------------------CACCCTATCAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAATAATTAATC-GGATGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAAAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG  

Sebaea_exacoides_AF102481               AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------CTTTCTGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-TAAATGATAAATCTTTCCTTCAAAA-TTTCG-----------------AAAGGAT----------------GAAG-AAGAAGGG------TCTA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CA---------------GA-T----GACCCGAATAAAT----CTGTATTTTT-TCTAGGA----AAAGTGGAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAATA-----TATAATATTCATTGAACAAATGTTTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----AGTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG  

Sebaea_cf_macrophylla_AF102482          AATTGGATTGAGCGTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACC-TGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------CTTT?TGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-TAAA-------TCTTTCCTTCAAAA-TTTCG-----------------AAAGGAT----------------GAAG-AAGAAGGG------TCTA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CA---------------GA-T----GACCCGAATAAAT----CTGTATTTTT-TCTAGGA----AAAGTGGAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAATA-----TATAATATTCATTGAACAAATGTTTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----AGTAGT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATA?T-AAGAAG  

Stapelia_peglerae_AF102483              AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATTCTGAGCCAAATCCTATTTT------------------------------------------------CAGGTTCGG---------AAAACGAACACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGAATACTATAG-----------------AAAAT-----TATTAATGA-C----AATCCAAATTCTT----CCGT--TT-TTTATAGAA----AAAACGGAAGAATT------GGTGTGAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGAATAAAGATAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------CAATTTTGAGT-AAGAGG

Strychnos_tomentosa_AF102485            -ATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------A----------------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTAAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTTTTTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG  

Strychnos_nux-vomica_AF02484            AATTGGATTGAGCCTTGGTATGG?AACCTACTAAGTG?TAACTTTCAAATTCAGAGAAACCCTGGAATTATT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-TAAA-------TCTTTCCATCGAAAATTCAG-----------------A----------------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTTTTTTATATTA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAACAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Swertia_marginata_AF102486              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG--AAAAG---AACAGCTCAG---------AAA-AAAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Swertia_perennis_X75708                 AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG--AAAAGA--GACGGCTCAG---------AAA-AAAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-GGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCTTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Symbolanthus_sp_AF102487                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT---------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Symbolanthus_pulcherrimus_AF102488      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCC?G-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATATT-AAGAGG  

Symbolanthus_cf_calygonus_AF102489      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT---------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Symphyllophyton_caprifolioides_AF102490 AATTGGATTGAGCCTTAGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAACCCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG  

Tachiadenus_carinatus_AF102491          AATTGGATTGAGCCTTGGTATGGAAACCTA?TAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTACGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-TAAA-------TCTTTCCTTCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACCCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------GGTGTGAA-----GCAATTCCACATTCAACAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATAACGACAACAATG-----------------CAATTTATAGT-AAGAAG  

Tachia_loretensis_AF102492              AATTGGATTGAGCCTTGGTATGTAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Telosma_cordata_AF102493                AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------------------------------------------CAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATCGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCCAATGAGT----CTGTATTT-TTTCTATAA-----AAACGGAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCTTCTTT--TCAAGAACTGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------CAATTTTGAGT-AAGAGG  

Tetrapollinia_caerulescens_AF102494     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GCAG-AAGAAGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Urogentias_ulugurensis_AF102495         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTTTTTTT------------TTTCCAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAA---------AGGATAGGTGCAAAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATGATTCAC-CCACAGCCTG-TAGA---TCCTT--TCACGAACCG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG  

Usteria_guineensis_AF102496             AATTAGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAATCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTAGAT------------------------------TAATGA-C----AACCCGAATGAAT----CTGTGTTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCGTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTAATCAAATGATTCACTCCACAGTCT-ATAGA---TCATT--TCAACAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTCTAGT-AAGAGG  

Valeriana_officinalis_X85795            ------------CCTTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCGGTTTTT----------GTTTTCCGAAA-------AC----------------AAAGGCT-A----------AAATCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATAGA--------GTTGACTG-G-------GTTGGTAAAAAGAA-------TCCTTCCATAGAAACTTCAG--------AAAAG----AAAGGA-----------------GAAGCTATAAACAGG----GATA-------TAC-T-AAA---------TACTATAGACTCTAC-----------------CAACT-----GATTAATGAAC----GACCCGAAT--------CTGTATTATCAAAA-TGGG---AAAAT----GA-TT---------GTGAA-----TTGATTCCATATTGAAGAAAGAA-----TCGAATACTCATTGAT?AAATCATTCACTCCATAGTCTG??CGA---TCT?T--TGAAGAACTG---ATTAAT-------C-GAACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGCCAATGCCGGCAACAATG-----------------AAAT??AGAGT-AAGAGG  

Veratrilla_baillonii_AF102497           AA?TGGATTGAGCCTTGGTATGGAAACTTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTAAA---------------AAAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAGA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG  

Wurdackanthus_frigidus_AF02498          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-TAGAGG  

Xestaea_lisianthoides_AF102499          AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------CAATGGA--------GTTGATTG-CGTTGGT-GTTGGTCGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------CAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATATCTTG-TATA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG  

 

*Hydrangea_paniculata_X85796;

;